The Infona portal uses cookies, i.e. strings of text saved by a browser on the user's device. The portal can access those files and use them to remember the user's data, such as their chosen settings (screen view, interface language, etc.), or their login data. By using the Infona portal the user accepts automatic saving and using this information for portal operation purposes. More information on the subject can be found in the Privacy Policy and Terms of Service. By closing this window the user confirms that they have read the information on cookie usage, and they accept the privacy policy and the way cookies are used by the portal. You can change the cookie settings in your browser.
The present study reports the distribution of a 35-bp mitochondrial DNA (mtDNA) D-loop tandemly repeated sequence in the populations of a North American freshwater catfish, Pylodictis olivaris, and the important role of a past geological event in the phylogeographic pattern of this species. A total of 330 individuals of flathead catfish, representing 34 drainages throughout the species' native range...
The genetic fidelity of in vitro-raised plants of three successive regenerations of Nepenthes khasiana Hook. f. was assessed using three different single primer amplification reaction (SPAR) methods, viz., random amplified polymorphic DNA (RAPD), inter-simple sequence repeat (ISSR) and direct amplification of minisatellite DNA region (DAMD) markers. Out of 80 RAPD primers screened, 14 primers reflected...
Tacrolimus (Tac) is an immunosuppressive drug widely used to avoid organ rejection. New-onset diabetes after transplantation (NODAT) is a major complication among transplanted patients who receive Tac. The increased risk for NODAT could be partly mediated by the effect of Tac on mitochondria from pancreatic beta-cells. Common and rare mitochondrial DNA variants have been linked to the risk of diabetes...
Biochemical detection of inborn errors of creatine metabolism or transport relies on the analysis of three main metabolites in biological fluids: guanidinoacetate (GAA), creatine (CT) and creatinine (CTN). Unspecific clinical presentation of the diseases might be the cause that only few patients have been diagnosed so far. We describe a LC–MS/MS method allowing fast and reliable diagnosis by simultaneous...
This is the first report for a Japanese case of arthrochalasia type of Ehlers–Danlos syndrome (EDS). A 46-year-old woman consulted us for joint hypermobility and skin hyperextensibility that had been present soon after birth. There was no family history of a similar disease. She was diagnosed as having bilateral congenital hip dislocation and bilateral habitual shoulder dislocation at her childhood...
The TGF-β signaling pathway controls cellular proliferation, growth and differentiation and regulates several functions of the connective tissue. Disruption of genes coding for components of the TGF-β signaling pathway or its interactors, such as fibrillin-1, has been shown to cause several human pathologies. Large deletions and non-sense mutations in TGFB2 gene have been recently described in patients...
Camellia chekiangoleosa is an important species of genus Camellia. It provides high-quality edible oil and has great ornamental value. The flowers are big and red which bloom between February and March. Flower pigmentation is closely related to the accumulation of anthocyanin. Although anthocyanin biosynthesis has been studied extensively in herbaceous plants, little molecular information on the anthocyanin...
Papillon–Lefèvre syndrome (PLS) is a rare autosomal recessive disorder characterized by hyperkeratosis involving the palms, soles, elbows, and knees followed by periodontitis, destruction of alveolar bone, and loss of primary and permanent teeth. Mutations of the lysosomal protease cathepsin C gene (CTSC) have been shown to be the genetic cause of PLS. This study analyzed CTSC mutations in five Iranian...
Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital...
We have scanned the Phytophthora infestans, P. ramorum, and P. sojae genomes for the presence of putative pectin methylesterase genes and conducted a sequence analysis of all gene models found. We also searched for potential regulatory motifs in the promoter region of the proposed P. infestans models, and investigated the gene expression levels throughout the course of P. infestans infection on potato...
Jumonji (Jmj) proteins are histone demethylases, which control the identity of stem cells. Jmj genes were characterized from plants to mammals where they have been implicated in the epigenetic regulation of development. Despite the Pacific oyster Crassostrea gigas representing one of the most important aquaculture resources worldwide, the molecular mechanisms governing the embryogenesis and reproduction...
The possible association of angiotensin type 2 receptor (AT2R) −1332 G:A polymorphism with susceptibility to preeclampsia was studied in 252 women consisted of 155 women with preeclampsia and 97 healthy pregnant women. Also, the interaction of this polymorphism with angiotensin type 1 receptor (AT1R) 1166 A:C, angiotensin converting enzyme insertion/deletion (ACE I/D) and also with matrix metalloproteinase-9...
We report on a consanguineous Pakistani family with a severe congenital microcephaly syndrome resembling the Seckel syndrome and Jawad syndrome. The affected individuals in this family were born to consanguineous parents of whom the mother presented with mild intellectual disability (ID), epilepsy and diabetes mellitus. The two living affected brothers presented with microcephaly, white matter disease...
Wilson's disease (WD) is a rare disorder of copper metabolism resulting in accumulation of copper in liver and other organs. We present a liver failure patient, who was misdiagnosed for two years, with normal ceruloplasmin and low serum alkaline phosphatase. Molecular testing revealed a novel p.Ala982Thr mutation within ATP7B gene. The pathology of liver sample showed a large amount of copper deposition...
As a tumor suppressor, FEN1 plays an essential role in preventing tumorigenesis. Two functional germline variants (-69G>A and 4150G>T) in the FEN1 gene have been associated with DNA damage levels in coke-oven workers and multiple cancer risk in general populations. However, it is still unknown how these genetic variants are involved in breast cancer susceptibility.We investigated the association...
Members of subclass Copepoda are abundant, diverse, and—as a result of their variety of ecological roles in marine and freshwater environments—important, but their phylogenetic interrelationships are unclear. Recent studies of arthropods have used gene arrangements in the mitochondrial (mt) genome to infer phylogenies, but for copepods, only seven complete mt genomes have been published. These data...
Systemic lupus erythematosus (SLE) is one of the common autoimmune diseases, with complex genetic components. Interleukin-21 (IL-21) is the most recently discovered member of the type-I cytokine family, which has a variety of effects on the immune system, including B cell activation, plasma cell differentiation, and immunoglobulin production. Previous studies have identified that IL-21 was associated...
A standardised methodology has been used to define genotypes based on pairwise sequence comparisons (PASC). PASC is a widely accepted method in virus taxonomy, which is based on the histogram of pairwised differences among sequences. Recently, Zhang et al. (2013) concluded that the average p-distance of duck circovirus (DuCV) between genotypes 1 and 2 was 0.170, and subtype distance thresholds were...
Selection of reference genes in Brassica napus, a tetraploid (4×) species, is a very difficult task without information on genome and transcriptome. By now, only several traditional reference genes which show significant expression differentiation under different conditions are used in B. napus. In the present study, based on genome and transcriptome data of the rapeseed Zhongshuang-11 cultivar, 14...
Set the date range to filter the displayed results. You can set a starting date, ending date or both. You can enter the dates manually or choose them from the calendar.